Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
mmu_circRNA_014961 | |||
Gene | ZMIZ1 | Organism | Mouse |
Genome Locus | n/a | Build | n/a |
Disease | Myocardial infarction induced heart failure | ICD-10 | Cardiovascular disease, unspecified (I51.6) |
DBLink | Link to database | PMID | 27336675 |
Experimental Method | |||
Sample Type | Heart Ventricles | Comparison | Ten mice each group were euthanized and 20 mg left ventricular tissues was collected and stored in liquid nitrogen |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TGGACCTGGGCTACAGACTCTT ReverseCTCCTGCCAGTCGATCACAAC | Statistics | Fold Change : Downregulated,2.401 pvalue : p=0.022 |
Citation | |||
Wu, HJ, Zhang, CY, Zhang, S, Chang, M, Wang, HY (2016). Microarray Expression Profile of Circular RNAs in Heart Tissue of Mice with Myocardial Infarction-Induced Heart Failure. Cell. Physiol. Biochem., 39, 1:205-16. |